NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene View larger

NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene


New product

Data sheet of NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032592
Product type: DNA & cDNA
Ncbi symbol: NOP5/NOP58
Origin species: Human
Product name: NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene
Size: 2ug
Accessions: BC032592
Gene id: 51602
Gene description: nucleolar protein NOP5/NOP58
Synonyms: NOP58 ribonucleoprotein; nucleolar protein NOP5/NOP58; NOP58 ribonucleoprotein homolog; NOP5/NOP58; HSPC120; NOP5; nucleolar protein 58; nucleolar protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggtgctgtttgaaacgtctgtgggttacgccatctttaaggttctaaatgagaagaaacttcaagaggttgatagtttatggaaagaatttgaaactccagagaaagcaaacaaaatagtaaagctaaaacattttgagaaatttcaggatacagcagaagcattagcagcattcacagctctgatggagggcaaaatcaataagcagctgaaaaaagttctgaagaaaatagtaaaagaagcccatgaaccgctggcagtagctgatgctaaactaggaggggtcataaaggaaaagctgaatctcagttgtatccatagtcctgttgttaatgaacttatgagaggaattcgttcacaaatggatggattaatccctggggtagaaccacgtgaaatggcagctatgtgtcttggattggctcacagcctgtctcgatatagattgaagtttagcgctgataaagtagacacaatgattgttcaggcaatttccttgttagatgacttggataaagaactaaacaactacattatgcgatgtagagaatggtatggctggcatttccctgaattaggaaaaattatttcagataatttaacatactgcaagtgtttacagaaagttggcgataggaagaactatgcctctgccaagctttctgagttgctgccagaagaagttgaagcagaagtgaaagcagctgcagagatatcaatgggaacagaggtttcagaagaagatatttgcaatattctgcatctttgcacccaggtgattgaaatctctgaatatcgaacccagctctatgaatatctacaaaatcgaatgatggccattgcacccaatgttacagtcatggttggggaattagttggagcacggcttattgctcatgcaggttctcttttaaatttggccaagcatgcagcttctaccgttcagattcttggagctgaaaaggcacttttcagagccctcaaatctagacgggatacccctaagtatggtctcatttatcatgcttcactcgtgggccagacaagtcccaaacacaaaggaaagatttctcgaatgctggcagccaaaaccgttttggctatccgttatgatgcttttggtgaggattcaagttctgcaatgggagttgagaacagagccaaattagaggccaggttgagaactttggaagacagagggataagaaaaataagtggaacaggaaaagcattagcaaaaacagaaaaatatgaacacaaaagtgaagtgaagacttacgatccttctggtgactccacacttccaacctgttctaaaaaacgcaaaatagaacaggtagataaagaggatgaaattactgaaaagaaagccaaaaaagccaagattaaagttaaagttgaagaagaggaagaagaaaaagtggcagaagaagaagaaacatctgtgaagaagaagaagaaaaggggtaaaaagaaacacattaaggaagaaccactttctgaggaagaaccatgtaccagcacagcaattgctagtccagagaaaaagaagaaaaagaaaaaaaagagagagaacgaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dispatched homolog 1 (Drosophila)
- Pentatricopeptide repeat domain 3
- mucin 20, cell surface associated
- cytochrome b-245, beta polypeptide

Buy NOP5/NOP58-nucleolar protein NOP5/NOP58 Gene now

Add to cart