Login to display prices
Login to display prices
CYP1A1-cytochrome P450, family 1, subfamily A, polypeptide 1 Gene View larger

CYP1A1-cytochrome P450, family 1, subfamily A, polypeptide 1 Gene

PTXBC023019

New product

Data sheet of CYP1A1-cytochrome P450, family 1, subfamily A, polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP1A1-cytochrome P450, family 1, subfamily A, polypeptide 1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC023019
Ncbi symbol: CYP1A1
Product name: CYP1A1-cytochrome P450, family 1, subfamily A, polypeptide 1 Gene
Size: 2ug
Accessions: BC023019
Gene id: 1543
Gene description: cytochrome P450, family 1, subfamily A, polypeptide 1
Synonyms: AHH; AHRR; CP11; CYP1; CYPIA1; P1-450; P450-C; P450DX; cytochrome P450 1A1; aryl hydrocarbon hydroxylase; cytochrome P1-450, dioxin-inducible; cytochrome P450 form 6; cytochrome P450, family 1, subfamily A, polypeptide 1; cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1; cytochrome P450-C; cytochrome P450-P1; flavoprotein-linked monooxygenase; xenobiotic monooxygenase; cytochrome P450 family 1 subfamily A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttttcccaatctccatgtcggccacggagtttcttctggcctctgtcatcttctgtctggtattctgggtaatcagggcctcaagacctcaggtccccaaaggcctgaagaatccaccagggccatggggctggcctctgattgggcacatgctgaccctgggaaagaacccgcacctggcactgtcaaggatgagccagcagtatggggacgtgctgcagatccgaattggctccacacccgtggtggtgctgagcggcctggacaccatccggcaggccctggtgcggcagggcgatgatttcaagggccggcccgacctctacaccttcaccctcatcagtaatggtcagagcatgtccttcagcccagactctggaccagtgtgggctgcccgccggcgcctggcccagaatggcctgaaaagtttctccattgcctctgacccagcctcctcaacctcctgctacctggaagagcatgtgagcaaggaggctgaggtcctgataagcacgttgcaggagctgatggcagggcctgggcactttaacccctacaggtatgtggtggtatcagtgaccaatgtcatctgtgccatttgctttggccggcgctatgaccacaaccaccaagaactgcttagcctagtcaacctgaataataatttcggggaggtggttggctctggaaacccagctgacttcatccctattcttcgctacctacccaacccttccctgaatgccttcaaggacctgaatgagaagttctacagcttcatgcagaagatggtcaaggagcactacaaaacctttgagaagggccacatccgggacatcacagacagcctgattgagcactgtcaggagaagcagctggatgagaacgccaatgtccagctgtcagatgagaagatcattaacatcgtcttggacctctttggagctgggtttgacacagtcacaactgctatctcctggagcctcatgtatttggtgatgaaccccagggtacagagaaagatccaagaggagctagacacagtgattggcaggtcacggcggccccggctctctgacagatcccatctgccctatatggaggccttcatcctggagaccttccgacactcttccttcgtccccttcaccatcccccacagcacaacaagagacacaagtttgaaaggcttttacatccccaaggggcgttgtgtctttgtaaaccagtggcagatcaaccatgaccagaagctatgggtcaacccatctgagttcctacctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgagaccattgcccgctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagcacttccaaatgcagctgcgctcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: