Cart 14 Product Products 3 116,93 € (empty)
-
1 x DKFZP434K0...113,40 € -
1 x ERLIN1-ER...121,50 € -
1 x TSPO-trans...113,40 € -
1 x SNAP23-syn...113,40 € -
1 x Goat...333,10 € -
1 x EPN3-epsin...113,40 € -
1 x ETS1-v-ets...121,50 € -
1 x FIBP-fibro...121,50 € -
1 x KIAA1143-K...113,40 € -
-
-
1 x SUMF2-sulf...113,40 € -
-
No products
To be determined Shipping
3 116,93 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 116,93 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 116,93 €
Data sheet of SHPK-sedoheptulokinase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SHPK-sedoheptulokinase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020543 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SHPK |
| Origin species: | Human |
| Product name: | SHPK-sedoheptulokinase Gene |
| Size: | 2ug |
| Accessions: | BC020543 |
| Gene id: | 23729 |
| Gene description: | sedoheptulokinase |
| Synonyms: | CARKL; SHK; sedoheptulokinase; carbohydrate kinase-like protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcgcggccgatcaccctcggcattgacctgggcaccacatctgtgaaggcagctctgctgagggccgcgcccgacgacccatccgggttcgcagtgctggcgagctgtgcccgtgctgcgcgggcagaggcggcggtcgagagcgcggtggccgggccccaggggcgggagcaggatgtgagtagaatcctccaagccctacacgagtgccttgctgcccttccccgaccccagctccggagcgtcgtgggcatcggggtgtcgggccagatgcatggagtcgtgttttggaaaacaggccaaggctgtgaatggacagagggagggattaccccggtgttcgagccccgagctgttagccacctggtcacgtggcaggatggccgatgtagcagcgaattcctggcctctctgccccagccgaagtctcatctcagtgtggccacgggcttcggctgtgcaaccatcttctggcttttgaaatatcgcccagagttcctgaagtcctacgacgcagccggtaccatccacgactatgtggttgccatgctgtgtggcttgccaagacctctgatgtccgaccagaatgctgccagctggggctatttcaacacgcagagccaaagctggaacgtagagacactgaggagctcgggttttcctgtccacctgctcccagacatcgccgagcctggcagtgtggcgggcagaacttcccacatgtggtttgaaatcccaaaggggacgcaggtgggagtggccttgggtgatttacaggcctctgtctattcctgcatggcccagaggacagatgcagttctcaacatcagcacctcggttcagctggcagcctccatgccttcaggattccagcctgcacagactccagaccctacggccccagtcgcctacttcccatacttcaacaggacctacctgggggtggccgcgtcactcaacgggggcaatgtgctggccacgttcgtccacatgctggttcagtggatggcagatctaggcctggaggttgaagaatccactgtgtattcacgcatgattcaggcagctgtgcagcagagagatacccacctgaccatcaccccgacagtgctgggggagaggcacctgccggaccagctggcctcagtgaccagaatctcctcctccgacctctccctggggcacgtgacccgggctctgtgccgaggcattgttcagaacctgcactccatgcttccgattcagcagctccaggagtggggcgtggagagggtgatgggcagtgggagtgcgctgtccaggaatgacgtgctgaagcaggaggtgcagagggctttccctttgcccatgtcctttgggcaggatgtggatgcagctgtcggggcagctctggtcatgctccggagacacctcaaccagaaggaatcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDC-like kinase 1 - CDC-like kinase 2 - fyn-related kinase - laminin, alpha 4 |