CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene View larger

CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008481
Product type: DNA & cDNA
Ncbi symbol: CAP2
Origin species: Human
Product name: CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene
Size: 2ug
Accessions: BC008481
Gene id: 10486
Gene description: CAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms: adenylyl cyclase-associated protein 2; 2810452G09Rik; CAP 2; CAP, adenylate cyclase-associated protein, 2 (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacatgcagggactggtggaaagactggaacgagctgtcagccgcctggagtcgctgtctgcagagtcccacaggccccctgggaactgcggggaagtcaatggtgtcattgcaggtgtggcaccctccgtggaagcctttgacaagctgatggacagtatggtggccgagtttttaaagaacagtaggatccttgctggggacgtggagacccatgcagaaatggtgcacagtgctttccaggcccagcgggctttccttctgatggcctctcagtaccaacaaccccacgagaatgacgtggccgcacttctgaaacccatatcggaaaagattcaggaaatccaaactttcagagagagaaaccgggggagtaacatgtttaatcatctttcggccgtcagcgaaagcatccctgcccttggatggatagctgtgtctcccaaacctggtccttatgtcaaggagatgaatgacgctgccaccttttacactaacagggtcttaaaggactacaaacacagtgatttgcgtcatgtggattgggtgaagtcatatttgaacatttggagtgaacttcaagcatacatcaaggaacaccacaccacgggcctcacatggagcaaaacaggtcctgtagcatccacagtatcagcgttttctgtcctctcctctgggcctggccttcctccaccccctcctcctctgcctcctccagggccacctccacttttcgagaatgaaggcaaaaaagaggaatcttctccttcacgctcagctttatttgcccaacttaaccagggagaagcaattacaaaagggctccgccatgtcacagatgaccagaagacatacaaaaatcccagcctgcgggctcaaggagggcaaactcaatctcccaccaaaagtcacactccaagtcccacatctcctaaatcttatccttctcaaaaacatgccccagtgttggagttggaaggaaagaaatggagagtggagtaccaagaggacaggaatgaccttgtgatttcagagactgagctgaaacaagtggcttacattttcaaatgcgaaaaatcaactattcagataaaagggaaagtaaactccattataattgacaactgtaagaaactcggcctggtgtttgacaatgtggtgggcattgtggaagtgatcaactcccaggacattcaaatccaggtaatggggagagtgccaacaatttccattaataagacagaaggttgccacatatacctcagtgaagatgcattagactgtgagatcgtgagcgccaagtcatctgaaatgaacatacttatccctcaggatggtgattatagagaatttcccattcctgaacagttcaagacagcatgggatggatccaagttaatcactgaacctgcagaaattatggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-aminobutyric acid (GABA) A receptor, alpha 3
- enhancer of mRNA decapping 3 homolog (S. cerevisiae)
- ash2 (absent, small, or homeotic)-like (Drosophila)
- gamma-aminobutyric acid (GABA) A receptor, alpha 4

Buy CAP2-CAP, adenylate cyclase-associated protein, 2 (yeast) Gene now

Add to cart