MEF2C-myocyte enhancer factor 2C Gene View larger

MEF2C-myocyte enhancer factor 2C Gene

PTXBC026341

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEF2C-myocyte enhancer factor 2C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MEF2C-myocyte enhancer factor 2C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026341
Product type: DNA & cDNA
Ncbi symbol: MEF2C
Origin species: Human
Product name: MEF2C-myocyte enhancer factor 2C Gene
Size: 2ug
Accessions: BC026341
Gene id: 4208
Gene description: myocyte enhancer factor 2C
Synonyms: C5DELq14.3; DEL5q14.3; myocyte-specific enhancer factor 2C; MADS box transcription enhancer factor 2, polypeptide C; myocyte enhancer factor 2C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggagaaaaaagattcagattacgaggattatggatgaacgtaacagacaggtgacatttacaaagaggaaatttgggttgatgaagaaggcttatgagctgagcgtgctgtgtgactgtgagattgcgctgatcatcttcaacagcaccaacaagctgttccagtatgccagcaccgacatggacaaagtgcttctcaagtacacggagtacaacgagcagcatgagagccggacaaactcagacatcgtggagacgttgagaaagaagggccttaatggctgtgacagcccagaccccgatgcggacgattccgtaggtcacagccctgagtctgaggacaagtacaggaaaattaacgaagatattgatctaatgatcagcaggcaaagattgtgtgctgttccacctcccaacttcgagatgccagtctccatcccagtgtccagtcacaacagtttggtgtacagcaaccctgtcagctcactgggaaaccccaacctattgccactggctcacccttctctgcagaggaatagtatgtctcctggtgtaacacatcgacctccaagtgcaggtaacacaggtggtctgatgggtggagacctcacgtctggtgcaggcaccagtgcagggaacgggtatggcaatccccgaaactcaccaggtctgctggtctcacctggtaacttgaacaagaatatgcaagcaaaatctcctcccccaatgaatttaggaatgaataaccgtaaaccagatctccgagttcttattccaccaggcagcaagaatacgatgccatcagtgtctgaggatgtcgacctgcttttgaatcaaaggataaataactcccagtcggctcagtcattggctaccccagtggtttccgtagcaactcctactttaccaggacaaggaatgggaggatatccatcagccatttcaacaacatatggtaccgagtactctctgagtagtgcagacctgtcatctctgtctgggtttaacaccgccagcgctcttcaccttggttcagtaactggctggcaacagcaacacctacataacatgcaaccatctgccctcagtcagttgggagcttgcactagcactcatttatctcagagttcaaatctctccctgccttctactcaaagcctcaacatcaagtcagaacctgtttctcctcctagagaccgtaccaccaccccttcgagatacccacaacacacgcgccacgaggcggggagatctcctgttgacagcttgagcagctgtagcagttcgtacgacgggagcgaccgagaggatcaccggaacgaattccactcccccattggactcaccagaccttcgccggacgaaagggaaagtccctcagtcaagcgcatgcgactttctgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Kruppel-like factor 4 (gut)
- kelch domain containing 4
- myocyte enhancer factor 2A
- sperm associated antigen 8

Buy MEF2C-myocyte enhancer factor 2C Gene now

Add to cart