GPR177-G protein-coupled receptor 177 Gene View larger

GPR177-G protein-coupled receptor 177 Gene

PTXBC007211

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR177-G protein-coupled receptor 177 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR177-G protein-coupled receptor 177 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007211
Product type: DNA & cDNA
Ncbi symbol: GPR177
Origin species: Human
Product name: GPR177-G protein-coupled receptor 177 Gene
Size: 2ug
Accessions: BC007211
Gene id: 79971
Gene description: G protein-coupled receptor 177
Synonyms: integral membrane protein GPR177; GPR177; C1orf139; EVI; MRP; mig-14; protein wntless homolog; G protein-coupled receptor 177; protein evenness interrupted homolog; wntless Wnt ligand secretion mediator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagatgagtccttggttccaattcatgctgtttatcctgcagctggacattgccttcaagctaaacaaccaaatcagagaaaatgcagaagtctccatggacgtttccctggcttaccgtgatgacgcatttgctgagtggactgaaatggcccatgaaagagtaccacggaaactcaaatgcaccttcacatctcccaagactccagagcatgagggccgttactatgaatgtgatgtccttcctttcatggaaattgggtctgtggcccataagttttaccttttaaacatccggctgcctgtgaatgagaagaagaaaatcaatgtgggaattggggagataaaggatatccggttggtggggatccaccaaaatggaggcttcaccaaggtgtggtttgccatgaagaccttccttacgcccagcatcttcatcattatggtgtggtattggaggaggatcaccatgatgtcccgacccccagtgcttctggaaaaagtcatctttgcccttgggatttccatgacctttatcaatatcccagtggaatggttttccatcgggtttgactggacctggatgctgctgtttggtgacatccgacagggcatcttctatgcgatgcttctgtccttctggatcatcttctgtggcgagcacatgatggatcagcacgagcggaaccacatcgcagggtattggaagcaagtcggacccattgccgttggctccttctgcctcttcatatttgacatgtgtgagagaggggtacaactcacgaatcccttctacagtatctggactacagacattggaacagagctggccatggccttcatcatcgtggctggaatctgcctctgcctctacttcctgtttctatgcttcatggtatttcaggtgtttcggaacatcagtgggaagcagtccagcctgccagctatgagcaaagtccggcggctacactatgaggggctaatttttaggttcaagttcctcatgcttatcaccttggcctgcgctgccatgactgtcatcttcttcatcgttagtcaggtaacggaaggccattggaaatggggcggcgtcacagtccaagtgaacagtgcctttttcacaggcatctatgggatgtggaatctgtatgtctttgctctgatgttcttgtatgcaccatcccataaaaactatggagaagaccagtccaatggcgatctgggtgtccatagtggggaagaactccagctcaccaccactatcacccatgtggacggacccactgagatctacaagttgacccgcaaggaggcccaggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin specific peptidase 25
- tripartite motif-containing 55
- tripartite motif-containing 38
- tripartite motif-containing 15

Buy GPR177-G protein-coupled receptor 177 Gene now

Add to cart