Login to display prices
Login to display prices
ZNF385D-zinc finger protein 385D Gene View larger

ZNF385D-zinc finger protein 385D Gene

PTXBC007212

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF385D-zinc finger protein 385D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF385D-zinc finger protein 385D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007212
Product type: DNA & cDNA
Ncbi symbol: ZNF385D
Origin species: Human
Product name: ZNF385D-zinc finger protein 385D Gene
Size: 2ug
Accessions: BC007212
Gene id: 79750
Gene description: zinc finger protein 385D
Synonyms: ZNF659; zinc finger protein 385D; zinc finger protein 659
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaaacataatgtattttggtggtacatgccagagtcctgctctcccggcccttgtccgtccaccagcccctcctttgcaaccatcgctggatattaaaccatttcttccctttcctcttgacactgcagctgcagtcaacctcttccccaatttcaatgcgatggacccgattcagaaagctgtaataaaccatacattcggggttcctcttccccaccgaagaaagcaaatcatatcatgcaacatttgccagttgagatttaattctgatagccaggctgcggcccactacaaaggcacgaaacatgccaagaagctcaaagcactggaagccatgaaaaataagcagaaatctgtaactgccaaggacagcgcaaagactaccttcacctccatcactaccaataccatcaataccagctctgacaaaacagacggtactgcagggacaccagcaatatcaacgacgacaactgtggaaatccgcaaaagcagtgttatgacaactgagatcacctctaaagtggaaaaaagcccaacgacagccactggcaatagctcatgtccttctactgagaccgaggaagaaaaggcaaaacggcttctttactgttcgctatgcaaggttgctgtcaactctgcctcgcagctggaggcgcacaacagtggtactaagcacaaaaccatgttagaagcccggaatggaagtggcactatcaaagcctttcctagggcaggagtgaaaggcaaaggacctgttaataaaggaaacacaggcctccaaaataaaacatttcactgtgaaatctgtgatgtgcacgtcaactcggaaacgcaacttaaacagcacattagcagtagaaggcacaaagacagagctgctgggaagcccccgaaacctaaatacagtccttacaacaaactacagaagacagcacatccactgggggtaaaattagtattttcaaaagaaccttcaaagccattggctccacgaattctaccaaaccctctagcagctgcagcagccgcagcagcagtggcagtgagttcccccttcagtcttcgaactgctccagcagcaacactgttccagacttctgcgcttcctccggcactcctgcggccagctcccggacccattcggaccgcccacactcctgtgctgtttgctccttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RUN domain containing 3A
- kelch domain containing 5
- hyaluronoglucosaminidase 3
- serine/threonine kinase 11