BGN-biglycan Gene View larger

BGN-biglycan Gene

PTXBC002416

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BGN-biglycan Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BGN-biglycan Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002416
Product type: DNA & cDNA
Ncbi symbol: BGN
Origin species: Human
Product name: BGN-biglycan Gene
Size: 2ug
Accessions: BC002416
Gene id: 633
Gene description: biglycan
Synonyms: DSPG1; PG-S1; PGI; SEMDX; SLRR1A; bone/cartilage proteoglycan-I; dermatan sulphate proteoglycan I; small leucine-rich protein 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcccctgtggcgcctcgtgtctctgctggccctgagccaggccctgccctttgagcagagaggcttctgggacttcaccctggacgatgggccattcatgatgaacgatgaggaagcttcgggcgctgacacctcaggcgtcctggacccggactctgtcacacccacctacagcgccatgtgtcctttcggctgccactgccacctgcgggtggttcagtgctccgacctgggtctgaagtctgtgcccaaagagatctcccctgacaccacgctgctggacctgcagaacaacgacatctccgagctccgcaaggatgacttcaagggtctccagcacctctacgccctcgtcctggtgaacaacaagatctccaagatccatgagaaggccttcagcccactgcggaagctgcagaagctctacatctccaagaaccacctggtggagatcccgcccaacctacccagctccctggtggagctccgcatccacgacaaccgcatccgcaaggtgcccaagggagtgttcagcgggctccggaacatgaactgcatcgagatgggcgggaacccactggagaacagtggctttgaacctggagccttcgatggcctgaagctcaactacctgcgcatctcagaggccaagctgactggcatccccaaagacctccctgagaccctgaatgaactccacctagaccacaacaaaatccaggccatcgaactggaggacctgcttcgctactccaagctgtacaggctgggcctaggccacaaccagatcaggatgatcgagaacgggagcctgagcttcctgcccaccctccgggagctccacttggacaacaacaagttggccagggtgccctcagggctcccagacctcaagctcctccaggtggtctatctgcactccaacaacatcaccaaagtgggtgtcaacgacttctgtcccatgggcttcggggtgaagcgggcctactacaacggcatcagcctcttcaacaaccccgtgccctactgggaggtgcagccggccactttccgctgcgtcactgaccgcctggccatccagtttggcaactacaaaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - podocan
- opsin 3
- granulin
- glucagon

Buy BGN-biglycan Gene now

Add to cart