WDR31-WD repeat domain 31 Gene View larger

WDR31-WD repeat domain 31 Gene

PTXBC012352

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR31-WD repeat domain 31 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR31-WD repeat domain 31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012352
Product type: DNA & cDNA
Ncbi symbol: WDR31
Origin species: Human
Product name: WDR31-WD repeat domain 31 Gene
Size: 2ug
Accessions: BC012352
Gene id: 114987
Gene description: WD repeat domain 31
Synonyms: WD repeat-containing protein 31; WD repeat domain 31
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctactcaggtgccaactgaaacaagctcctccacagaaggtttcgtttaggttttgtgtcgtgatggggaaacagcaaagcaaactcaaacacagcacttataaatacgggcctgatgaaattatagaagagagaattcaaactaaagcttttcaagagtatagcccagctcacatggataccgtctctgtcgtggctgctttgaactcagacctttgtgtctctggagggaaagataagacagttgtggcctataattggaaaactggaaatgtggtgaaaaggttcaaaggacatgaacatgagatcaccaaggtagcctgtattcccaaatccagccagttcttcagtgcctctcgtgacaggatggtcatgatgtgggacttgcacggttcctcacaaccaaggcagcaattgtgtggccatgccatggtggtcaccggattggctgtgagtccagactcatcacagctgtgcactggctctcgggacaacaccctgcttctgtgggatgtggtgacaggacagagtgtggaaagagcatctgtctccaggaacgtggtcactcacctgtgctgggtccccagagaaccatacatactacagacctctgaagataaaaccctcagattatgggacagtcgggggctgcaggtagctcatatgtttcctgcaaagcagcacattcagacctactgtgaagtcagtgtggatggacacaagtgtatctcctgcagcaatggctttggaggagaaggctgtgaagccacgttgtgggacctaagacagactcgaaacagaatatgtgagtataaggggcatttccagactgtcgcatcctgcgtctttctaccaagagcattggccttgatgcctttaattgctacctcatcacatgattgcaaggtgaagatttggaaccaagatactggagcctgccttttcaccttgtctctggatggatcaggacccttgacttctctggctgttggtgacgccatctccttattgtgtgcaagttttaacagaggaattcacttactcagaatggaccacagccaagggctggaactgcaggaagtggcagcattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Theg homolog (mouse)
- WD repeat domain 89
- KIAA0999 protein
- ribosomal protein L3

Buy WDR31-WD repeat domain 31 Gene now

Add to cart