ACTL8-actin-like 8 Gene View larger

ACTL8-actin-like 8 Gene

PTXBC028909

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTL8-actin-like 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTL8-actin-like 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028909
Product type: DNA & cDNA
Ncbi symbol: ACTL8
Origin species: Human
Product name: ACTL8-actin-like 8 Gene
Size: 2ug
Accessions: BC028909
Gene id: 81569
Gene description: actin-like 8
Synonyms: CT57; actin-like protein 8; actin like protein; cancer/testis antigen 57; actin like 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcaagaaccgttatcattgaccacgggtctggctttttgaaggctggcacggccggatggaatgagcctcagatggtcttcccgaacatcgtgaactacctaccgtgcaaggagaaccctggccccagctatgcccgtaggcgtgtgagcctgggcatcgacatttgccatcctgacacctttagctaccccatcgagcggggccgcatcctcaactgggagggtgtgcagtacctctggtcatttgtgttggagaaccacagacgggagcaagaggtcccccctgtgatcatcacggagacacccttgagggagcctgcggaccgaaagaagatgctggagatcctgtttgagttgctgcatgtcccatcggtcctcctggccgaccagctgcagatgtccctgtatgcctctggcctcctgaccggagtggtggttgattctggctatggcctgacccgcgtgcagcctttccaccagggccgccccttgcccgccagcggcaagacgctggagttcgccggccaggatctctccgcctatctcctcaagagtctctttaaggaagattgcgatagacgctgcctgtttcagctggagacagtcgccgtgactcagatgaacaagtgctacgtgccgcagaatctgggggaggccctggactttcgtgagaggcagcagagtgccttggatgagagcaacacctatcagctcccagacggctcccgcgtggagctgacccccatgcagcgggtggctcctgagatgttctttagcccgcaggtgttcgagcagccggggcccagcatcccacgggccattgtggaatccgtggagtcctgcgagatctccctgcgccccctgctggtctcccacgtgatggcctgcgggggcaacaccctctatcccgggttcacaaagcgcctgttcagggagctgatgggggatcacgtctcctccaccaaggccacagtctgggagggttccaatagaaactttagtgtctggctaggagcgtccgtggtggctcacctttctacctaccagtctgagtggatgtcccgagaggagtatggtgagcatatgaggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD34 molecule
- keratin 33B
- Enah/Vasp-like
- tubulin, beta

Buy ACTL8-actin-like 8 Gene now

Add to cart