Login to display prices
Login to display prices
MPPE1-metallophosphoesterase 1 Gene View larger

MPPE1-metallophosphoesterase 1 Gene

PTXBC002877

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPPE1-metallophosphoesterase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPPE1-metallophosphoesterase 1 Gene

Proteogenix catalog: PTXBC002877
Ncbi symbol: MPPE1
Product name: MPPE1-metallophosphoesterase 1 Gene
Size: 2ug
Accessions: BC002877
Gene id: 65258
Gene description: metallophosphoesterase 1
Synonyms: PGAP5; metallophosphoesterase 1; metallo phosphoesterase; post-GPI attachment to proteins factor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgatgatcgaattggggtttggaagacagaattttcatccattaaagaggaagagttcattgctgttgaaactcatagctgttgtctttgctgtgcttctattttgtgaatttttaatctattacttagcgatctttcagtgtaattggcctgaagtgaaaaccacagcctctgatggtgaacagaccacacgtgagcctgtgctcaaagccatgtttttggctgacacccatttgcttggggaattcctaggccactggctggacaaattacgaagggaatggcagatggagagagcgttccagacagctctgtggttgctgcagccggaagtcgtcttcatcctgggggatatctttgatgaagggaagtggagcacccctgaggcctgggcggatgatgtggagcggtttcagaaaatgttcagacacccaagtcatgtacagctgaaggtagttgctggaaaccatgacattggcttccattatgagatgaacacatacaaagtagaacgctttgagaaagtgttcagctctgaaagactgttttcttggaaaggcattaactttgtgatggtcaacagcgtggcgctgaacggggatggctgtggcatctgctctgaaacagaagcagagctcattgaagtttctcacagactgaactgctcccgagagctgctgtggtggctccagccgcgcctggttctcagtggccacacgcacagcgcctgcgaggtgcaccacgggggccgagtccccgagctcagcgtcccatctttcagttggaggaacagaaacaaccccagtttcatcatgggtagcatcacgcccacagactacaccctctccaagtgctacctcccacgtgaggatgtggttttgatcatctactgtggagtggtgggcttccttgtggtcctcacactcactcactttgggcttctagcctcaccttttctttctggtttgaacttgctcggaaagcgtaagacaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: