KYNU-kynureninase (L-kynurenine hydrolase) Gene View larger

KYNU-kynureninase (L-kynurenine hydrolase) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KYNU-kynureninase (L-kynurenine hydrolase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KYNU-kynureninase (L-kynurenine hydrolase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000879
Product type: DNA & cDNA
Ncbi symbol: KYNU
Origin species: Human
Product name: KYNU-kynureninase (L-kynurenine hydrolase) Gene
Size: 2ug
Accessions: BC000879
Gene id: 8942
Gene description: kynureninase (L-kynurenine hydrolase)
Synonyms: KYNUU; kynureninase; L-kynurenine hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccttcatctcttgagctgccggctgacacagtgcagcgcattgcggctgaactcaaatgccacccaacggatgagagggtggctctccacctagatgaggaagataagctgaggcacttcagggagtgcttttatattcccaaaatacaggatctgcctccagttgatttatcattagtgaataaagatgaaaatgccatctatttcttgggaaattctcttggccttcaaccaaaaatggttaaaacatatcttgaagaagaactagataagtgggccaaaatagcagcctatggtcatgaagtggggaagcgtccttggattacaggagatgagagtattgtaggccttatgaaggacattgtaggagccaatgagaaagaaatagccctaatgaatgctttgactgtaaatttacatcttctaatgttatcattttttaagcctacgccaaaacgatataaaattcttctagaagccaaagccttcccttctgatcattatgctattgagtcacaactacaacttcacggacttaacattgaagaaagtatgcggatgataaagccaagagagggggaagaaaccttaagaatagaggatatccttgaagtaattgagaaggaaggagactcaattgcagtgatcctgttcagtggggtgcatttttacactggacagcactttaatattcctgccatcacaaaagctggacaagcgaagggttgttatgttggctttgatctagcacatgcagttggaaatgttgaactctacttacatgactggggagttgattttgcctgctggtgttcctacaagtatttaaatgcaggagcaggaggaattgctggtgccttcattcatgaaaagcatgcccatacgattaaacctgcgagatcggagttctttaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ecto-NOX disulfide-thiol exchanger 2
- nuclear transcription factor Y, alpha
- chromosome 8 open reading frame 48
- chromosome 2 open reading frame 43

Buy KYNU-kynureninase (L-kynurenine hydrolase) Gene now

Add to cart