Login to display prices
Login to display prices
KYNU-kynureninase (L-kynurenine hydrolase) Gene View larger

KYNU-kynureninase (L-kynurenine hydrolase) Gene

PTXBC000879

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KYNU-kynureninase (L-kynurenine hydrolase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KYNU-kynureninase (L-kynurenine hydrolase) Gene

Proteogenix catalog: PTXBC000879
Ncbi symbol: KYNU
Product name: KYNU-kynureninase (L-kynurenine hydrolase) Gene
Size: 2ug
Accessions: BC000879
Gene id: 8942
Gene description: kynureninase (L-kynurenine hydrolase)
Synonyms: KYNUU; kynureninase; L-kynurenine hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccttcatctcttgagctgccggctgacacagtgcagcgcattgcggctgaactcaaatgccacccaacggatgagagggtggctctccacctagatgaggaagataagctgaggcacttcagggagtgcttttatattcccaaaatacaggatctgcctccagttgatttatcattagtgaataaagatgaaaatgccatctatttcttgggaaattctcttggccttcaaccaaaaatggttaaaacatatcttgaagaagaactagataagtgggccaaaatagcagcctatggtcatgaagtggggaagcgtccttggattacaggagatgagagtattgtaggccttatgaaggacattgtaggagccaatgagaaagaaatagccctaatgaatgctttgactgtaaatttacatcttctaatgttatcattttttaagcctacgccaaaacgatataaaattcttctagaagccaaagccttcccttctgatcattatgctattgagtcacaactacaacttcacggacttaacattgaagaaagtatgcggatgataaagccaagagagggggaagaaaccttaagaatagaggatatccttgaagtaattgagaaggaaggagactcaattgcagtgatcctgttcagtggggtgcatttttacactggacagcactttaatattcctgccatcacaaaagctggacaagcgaagggttgttatgttggctttgatctagcacatgcagttggaaatgttgaactctacttacatgactggggagttgattttgcctgctggtgttcctacaagtatttaaatgcaggagcaggaggaattgctggtgccttcattcatgaaaagcatgcccatacgattaaacctgcgagatcggagttctttaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: