Cart 7 Product Products 1 364,00 € (empty)
-
1 x HPRT1-hypo...113,40 € -
1 x DPT-dermat...113,40 € -
1 x FAM100A-fa...113,40 € -
-
-
1 x GTF2F2-gen...113,40 € -
1 x FAM106A-fa...113,40 €
No products
To be determined Shipping
1 364,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 364,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 364,00 €
Data sheet of OGN-osteoglycin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OGN-osteoglycin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037273 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OGN |
| Origin species: | Human |
| Product name: | OGN-osteoglycin Gene |
| Size: | 2ug |
| Accessions: | BC037273 |
| Gene id: | 4969 |
| Gene description: | osteoglycin |
| Synonyms: | OIF; SLRR3A; mimecan; corneal keratan sulfate proteoglycan; mimecan proteoglycan; osteoinductive factor; osteoglycin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagactctgcagtctacacttctcctgttactgcttgtgcctctgataaagccagcaccaccaacccagcaggactcacgcattatctatgattatggaacagataattttgaagaatccatatttagccaagattatgaggataaatacctggatggaaaaaatattaaggaaaaagaaactgtgataatacccaatgagaaaagtcttcaattacaaaaagatgaggcaataacaccattacctcccaagaaagaaaatgatgaaatgcccacgtgtctgctgtgtgtttgtttaagtggctctgtatactgtgaagaagttgacattgatgctgtaccacccttaccaaaggaatcagcctatctttacgcacgattcaacaaaattaaaaagctgactgccaaagattttgcagacatacctaacttaagaagactcgattttacaggaaatttgatagaagatatagaagatggtactttttcaaaactttctctgttagaagaactttcacttgctgaaaatcaactactaaaacttccagttcttcctcccaagctcactttatttaatgcaaaatacaacaaaatcaagagtaggggaatcaaagcaaatgcattcaaaaaactgaataacctcaccttcctctacttggaccataatgccctggaatccgtgcctcttaatttaccagaaagtctacgtgtaattcatcttcagttcaacaacatagcttcaattacagatgacacattctgcaaggctaatgacaccagttacatccgggaccgcattgaagagatacgcctggagggcaatccaatcgtcctgggaaagcatccaaacagttttatttgcttaaaaagattaccgatagggtcatacttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin C - syndecan 1 - cyclin M3 - septin 12 |