GJB1-gap junction protein, beta 1, 32kDa Gene View larger

GJB1-gap junction protein, beta 1, 32kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB1-gap junction protein, beta 1, 32kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GJB1-gap junction protein, beta 1, 32kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002805
Product type: DNA & cDNA
Ncbi symbol: GJB1
Origin species: Human
Product name: GJB1-gap junction protein, beta 1, 32kDa Gene
Size: 2ug
Accessions: BC002805
Gene id: 2705
Gene description: gap junction protein, beta 1, 32kDa
Synonyms: CMTX; CMTX1; CX32; gap junction beta-1 protein; GAP junction 28 kDa liver protein; connexin-32; gap junction protein, beta 1, 32kDa; gap junction protein beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactggacaggtttgtacaccttgctcagtggcgtgaaccggcattctactgccattggccgagtatggctctcggtcatcttcatcttcagaatcatggtgctggtggtggctgcagagagtgtgtggggtgatgagaaatcttccttcatctgcaacacactccagcctggctgcaacagcgtttgctatgaccaattcttccccatctcccatgtgcggctgtggtccctgcagctcatcctagtttccaccccagctctcctcgtggccatgcacgtggctcaccagcaacacatagagaagaaaatgctacggcttgagggccatggggaccccctacacctggaggaggtgaagaggcacaaggtccacatctcagggacactgtggtggacctatgtcatcagcgtggtgttccggctgttgtttgaggccgtcttcatgtatgtcttttatctgctctaccctggctatgccatggtgcggctggtcaagtgcgacgtctacccctgccccaacacagtggactgcttcgtgtcccgccccaccgagaaaaccgtcttcaccgtcttcatgctagctgcctctggcatctgcatcatcctcaatgtggccgaggtggtgtacctcatcatccgggcctgtgcccgccgagcccagcgccgctccaatccaccttcccgcaagggctcgggcttcggccaccgcctctcacctgaatacaagcagaatgagatcaacaagctgctgagtgagcaggatggctccctgaaagacatactgcgccgcagccctggcaccggggctgggctggctgaaaagagcgaccgctgctcggcctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S2
- thioredoxin domain containing 14
- craniofacial development protein 1
- mitochondrial ribosomal protein L1

Buy GJB1-gap junction protein, beta 1, 32kDa Gene now

Add to cart