GPBAR1-G protein-coupled bile acid receptor 1 Gene View larger

GPBAR1-G protein-coupled bile acid receptor 1 Gene

PTXBC033625

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPBAR1-G protein-coupled bile acid receptor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPBAR1-G protein-coupled bile acid receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033625
Product type: DNA & cDNA
Ncbi symbol: GPBAR1
Origin species: Human
Product name: GPBAR1-G protein-coupled bile acid receptor 1 Gene
Size: 2ug
Accessions: BC033625
Gene id: 151306
Gene description: G protein-coupled bile acid receptor 1
Synonyms: BG37; GPCR19; GPR131; M-BAR; TGR5; G-protein coupled bile acid receptor 1; G-protein coupled bile acid receptor BG37; G-protein coupled receptor GPCR19; membrane bile acid receptor; membrane-type receptor for bile acids; G protein-coupled bile acid receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgcccaacagcactggcgaggtgcccagccccattcccaagggggctttggggctctccctggccctggcaagcctcatcatcaccgcgaacctgctcctagccctgggcatcgcctgggaccgccgcctgcgcagcccacctgctggctgcttcttcctgagcctactgctggctgggctgctcacgggtctggcattgcccacattgccagggctgtggaaccagagtcgccggggttactggtcctgcctcctcgtctacttggctcccaacttctccttcctctccctgcttgccaacctcttgctggtgcacggggagcgctacatggcagtcctgaggccactccagccccctgggagcattcggctggccctgctcctcacctgggctggtcccctgctctttgccagtctgcccgctctggggtggaaccactggacccctggtgccaactgcagctcccaggctatcttcccagccccctacctgtacctcgaagtctatgggctcctgctgcccgccgtgggtgctgctgccttcctctctgtccgcgtgctggccactgcccaccgccagctgcaggacatctgccggctggagcgggcagtgtgccgcgatgagccctccgccctggcccgggcccttacctggaggcaggcaagggcacaggctggagccatgctgctcttcgggctgtgctgggggccctacgtggccacactgctcctctcagtcctggcctatgagcagcgcccgccactggggcctgggacactgttgtccctcctctccctaggaagtgccagtgcagcggcagtgcccgtagccatggggctgggcgatcagcgctacacagccccctggagggcagccgcccaaaggtgcctgcaggggctgtggggaagagcctcccgggacagtcccggccccagcattgcctaccacccaagcagccaaagcagtgtcgacctggacttgaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and SOCS box-containing 1
- pregnancy specific beta-1-glycoprotein 5
- splicing factor, arginine/serine-rich 6
- glycoprotein 2 (zymogen granule membrane)

Buy GPBAR1-G protein-coupled bile acid receptor 1 Gene now

Add to cart